spongebarcoding barcodeoflife Monaco JCR free counters
Free counters
CSM Database Menu

Primers

COI

Folmer et al. 1994

LCO1490: 5' GGTCAACAAATCATAAAGATATTGG 3'

HCO2198: 5' TAAACTTCAGGGTGACCAAAAAATCA 3'

Recommended for Hexacorallia:

Sinniger et al. 2010

LCOant: 5' TTTTCYACTAATCATAAAGATAT 3'

COIantr: 5' GCCCACACAATAAAGCCCAATAYYCCAAT 3'

(793 bp: this primer pair was designed based on zoanthids, scleractinians, antipatharians, Metridium and Sarcophyton, tested on zoanthids, scleractinians and sea anemones)

Recommended for Octocorallia:

McFadden et al. 2011

COII8068x-F: 5'- CCA TAA CAG GRC TWG CAG CAT C - 3'

COIOCT-R: 5' - ATC ATA GCA TAG ACC ATA CC - 3'

(900-950 bp: This primer pair also amplifies igr1, the intergenic region between COI and COII)

alternative COI primers (may be paired with COII8068x-F or COIOCT-R):

COI8414-F: 5' - CCAGGTAGTATGTTAGGRGA - 3' (McFadden unpubl.; starts at nt 135 of COI)

HCO2198-R: 5' - TAAACTTCAGGGTGACCAAAAAATCA - 3' (Folmer et al. 1994)

16S

Anthozoans

Sinniger et al. 2005

16Sant1a: 5' GCCATGAGTATAGACGCACA 3'

16SbmoH: 5' CGAACAGCCAACCCTTGG 3'

16Sant1a-16SbmoH: 650-780 bp

Sinniger et al. 2008

16Sarml: 5' GGCCTCGACTGTTTACCAAA 3'

16Sarml-16SbmoH: 430-540 bp

V5a: 5' ATTCGTAGTGAAGATGCTAC 3'

V5r: 5' TCGCCCCAACCAAACTGTCC 3'

Tested on zoanthids, sea anemones, scleractinians, antipatharians and cerianthids, 150-250bp.

Msh1

Octocorallians

ND42599F 5' GCCATTATGGTTAACTATTAC 3' (France & Hoover 2002))

mut3458R 5' TSGAGCAAAAGCCACTCC 3' (Sanchez et al. 2003)

an alternative forward primer is necessary for Keratoisidinae:

CO3BAM5657F 5' GCTGCTAGTTGGTATTGGCAT 3' (Brugler & France 2008)

ITS2

Flot & Tillier 2006

ITSc2-5: 5'-AGCCAGCTGCGATAAGTAGTG-3'

R28S1: 5'-GCTGCAATCCCAAACAACCC-3'

These primers works on all cnidarian tested and beyond (sponges, bryozoa,...), but they do not amplify the ITS2 of dinoflagellates such as Symbiodinium

The database structure and layout was generously provided by the Sponge Barcoding Project
Copyright "Centre Scientifique de Monaco" 2011
contact-us